dps Gene Page

Genbank name: dps
EcoGene name: dps
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG11415
   Reported site,genomic coordinates and site type: DPInteract 848247:848294 ihf
   Reported site,genomic coordinates and site type: DPInteract 848209:848247 oxyR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.93
Model logo: dps.1.model.LGO.gif
Sequence logo: dps.1.LGO.gif
Sequence Alignment: dps.1.ALGN
Solution location in genomic coordinates: 848220-848236 R
Solution sequence with flanking nucleotides: ttacc ACTATTAGTGTGATAGG aacag
Number of overlapping basepairs with reported site: 17
Site type: oxyR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.00
Model logo: dps.2.model.LGO.gif
Sequence logo: dps.2.LGO.gif
Sequence Alignment: dps.2.ALGN
Solution location in genomic coordinates: 848166-848189 R
Solution sequence with flanking nucleotides: gccgg TGCTATACTTAATCTCGTTAATTA ctggg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.38
Model logo: dps.3.model.LGO.gif
Sequence logo: dps.3.LGO.gif
Sequence Alignment: dps.3.ALGN
Solution location in genomic coordinates: 848394-848415 R
Solution sequence with flanking nucleotides: gcatg GTTATGCATAACCATGCAGAAT ttctc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: dps_ybiF_IR     Overlap: 22


Gene Index Page