dsbB Gene Page
Genbank name: dsbB
EcoGene name: dsbB
Divergent gene:
Species with an ortholog:
AA EC HI SP ST VC YP
EcoGene link: EG11393
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 12.74
Model logo: dsbB.1.model.LGO.gif
Sequence logo: dsbB.1.LGO.gif
Sequence Alignment: dsbB.1.ALGN
Solution location in genomic coordinates: 1232258-1232276 R
Solution sequence with flanking nucleotides: actct ATGCATATTGCAGGGAAAT gatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.25
Model logo: dsbB.2.model.LGO.gif
Sequence logo: dsbB.2.LGO.gif
Sequence Alignment: dsbB.2.ALGN
Solution location in genomic coordinates: 1232284-1232300 R
Solution sequence with flanking nucleotides: cgaat GAATTGGTTTAAACTGC gcact
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 10.48
Model logo: dsbB.3.model.LGO.gif
Sequence logo: dsbB.3.LGO.gif
Sequence Alignment: dsbB.3.ALGN
Solution location in genomic coordinates: 1232345-1232366 R
Solution sequence with flanking nucleotides: cggtt TGCCTTTTCGCCCGATAATTGT ccaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1232255-1232276 R
Solution sequence with flanking nucleotides: actct ATGCATATTGCAGGGAAATGAT t
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page