ebgR Gene Page
Genbank name: ebgR
EcoGene name: ebgR
Divergent gene: ygjH
Species with an ortholog:
AA EC HI YP
EcoGene link: EG10254
Species that contributed to the solution: AA EC HI YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.23
Model logo: ebgR.1.model.LGO.gif
Sequence logo: ebgR.1.LGO.gif
Sequence Alignment: ebgR.1.ALGN
Solution location in genomic coordinates: 3218906-3218929
Solution sequence with flanking nucleotides: taggg TAAAATTTTACTAAACTATAGCAA aagtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.50
Model logo: ebgR.2.model.LGO.gif
Sequence logo: ebgR.2.LGO.gif
Sequence Alignment: ebgR.2.ALGN
Solution location in genomic coordinates: 3219014-3219033
Solution sequence with flanking nucleotides: gcgtc AAAGAAACGCGCTTTATTTA ctgaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 1.63
Model logo: ebgR.3.model.LGO.gif
Sequence logo: ebgR.3.LGO.gif
Sequence Alignment: ebgR.3.ALGN
Solution location in genomic coordinates: 3218933-3218956
Solution sequence with flanking nucleotides: aaaag TTTTTCTCAATCCTGTAGGCTAAA aatgg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page