edd Gene Page
Genbank name: edd
EcoGene name: edd
Divergent gene:
Species with an ortholog:
EC PA SP ST VC YP
EcoGene link: EG10257
Reported site,genomic coordinates and site type: DPInteract 1932726:1932741 fruR
Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.99
Model logo: edd.1.model.LGO.gif
Sequence logo: edd.1.LGO.gif
Sequence Alignment: edd.1.ALGN
Solution location in genomic coordinates: 1932789-1932810 R
Solution sequence with flanking nucleotides: cgcag ATTGTAGAACAATTTTTACACT ttcag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 9.74
Model logo: edd.2.model.LGO.gif
Sequence logo: edd.2.LGO.gif
Sequence Alignment: edd.2.ALGN
Solution location in genomic coordinates: 1932729-1932750 R
Solution sequence with flanking nucleotides: ttttt ATTACACTGACTGAAACGTTTT tgccc
Number of overlapping basepairs with reported site: 13
Site type: fruR
Repeat: edd_zwf_IR     Overlap: 15
Solution location in genomic coordinates: 1932670-1932691 R
Solution sequence with flanking nucleotides: tcata AATCCTCTGAATGAAACGCGTT gtgaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 9.65
Model logo: edd.3.model.LGO.gif
Sequence logo: edd.3.LGO.gif
Sequence Alignment: edd.3.ALGN
Solution location in genomic coordinates: 1932695-1932716 R
Solution sequence with flanking nucleotides: tgagc TCCGGTTACAGGCGTTTCAGTC ataaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: edd_zwf_IR     Overlap: 22
Solution location in genomic coordinates: 1932635-1932656 R
Solution sequence with flanking nucleotides: tcctg CTCTGACAACTCAATTTCAGGA gcctt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page