emrA Gene Page

Genbank name: emrA
EcoGene name: emrA
Divergent gene:
Species with an ortholog: AA EC ST YP
EcoGene link: EG11354

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 18.33
Model logo: emrA.1.model.LGO.gif
Sequence logo: emrA.1.LGO.gif
Sequence Alignment: emrA.1.ALGN
Solution location in genomic coordinates: 2809369-2809392
Solution sequence with flanking nucleotides: tgact GGCCAGCATCGCAACATGCTGGCC ttttt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 14.25
Model logo: emrA.2.model.LGO.gif
Sequence logo: emrA.2.LGO.gif
Sequence Alignment: emrA.2.ALGN
Solution location in genomic coordinates: 2809404-2809424
Solution sequence with flanking nucleotides: gcaag CAGGTCGGCTCAGCCGATGAG ttaag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.44
Model logo: emrA.3.model.LGO.gif
Sequence logo: emrA.3.LGO.gif
Sequence Alignment: emrA.3.ALGN
Solution location in genomic coordinates: 2809335-2809354
Solution sequence with flanking nucleotides: ctcgc TCAAAAATCCAGATTTATAA aagaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page