emrD Gene Page

Genbank name: emrD
EcoGene name: emrD
Divergent gene: ivbL
Species with an ortholog: AA   EC   PA   SP   ST   VC   YP   
EcoGene link: EG11693

Species that contributed to the solution: AA EC SP VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.80
Model logo: emrD.1.model.LGO.gif
Sequence logo: emrD.1.LGO.gif
Sequence Alignment: emrD.1.ALGN
Solution location in genomic coordinates: 3851410-3851431
Solution sequence with flanking nucleotides: ttgtt TACATATTCTGCCGCTAAACAA ttccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.33
Model logo: emrD.2.model.LGO.gif
Sequence logo: emrD.2.LGO.gif
Sequence Alignment: emrD.2.ALGN
Solution location in genomic coordinates: 3851388-3851409
Solution sequence with flanking nucleotides: ccggc AACATTTATTGCCGCTTTTGTT tacat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 10.29
Model logo: emrD.3.model.LGO.gif
Sequence logo: emrD.3.LGO.gif
Sequence Alignment: emrD.3.ALGN
Solution location in genomic coordinates: 3851086-3851107
Solution sequence with flanking nucleotides: cacaa CGTTTCTCCTTGAGATACCGCG tgcac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3851157-3851178
Solution sequence with flanking nucleotides: cagtg CTCCTGAACCACAGGAGACGCG tatga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page