emrE Gene Page

Genbank name: emrE
EcoGene name: emrE
Divergent gene:
Species with an ortholog: EC   PA   ST   TF   YP   
EcoGene link: EG10629

Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.20
Model logo: emrE.1.model.LGO.gif
Sequence logo: emrE.1.LGO.gif
Sequence Alignment: emrE.1.ALGN
Solution location in genomic coordinates: 567509-567528
Solution sequence with flanking nucleotides: aattc TCTCCAGTTTGAACAGGAAA gaata
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: renD_emrE_IR     Overlap: 14

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 4.08
Model logo: emrE.2.model.LGO.gif
Sequence logo: emrE.2.LGO.gif
Sequence Alignment: emrE.2.ALGN
Solution location in genomic coordinates: 567481-567502
Solution sequence with flanking nucleotides: caggt GAGTTGAGTTCAAACTGTAGTA caatt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: renD_emrE_IR     Overlap: 15
Solution location in genomic coordinates: 567508-567529
Solution sequence with flanking nucleotides: caatt CTCTCCAGTTTGAACAGGAAAG aatat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: renD_emrE_IR     Overlap: 15

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 0.00
Model logo: emrE.3.model.LGO.gif
Sequence logo:
Sequence Alignment: emrE.3.ALGN
Solution location in genomic coordinates: 567492-567508
Solution sequence with flanking nucleotides: agttc AAACTGTAGTACAATTC tctcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: renD_emrE_IR     Overlap: 17


Gene Index Page