eno Gene Page
Genbank name: eno
EcoGene name: eno
Divergent gene:
Species with an ortholog:
EC HI PA SP ST TF VC YP
EcoGene link: EG10258
Species that contributed to the solution: EC HI PA SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 13.18
Model logo: eno.1.model.LGO.gif
Sequence logo: eno.1.LGO.gif
Sequence Alignment: eno.1.ALGN
Solution location in genomic coordinates: 2905988-2906010 R
Solution sequence with flanking nucleotides: acgcg TTGTTTGTCTGGAGTTTCAGTTT aacta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: eno_pyrG_IR     Overlap: 3
Solution location in genomic coordinates: 2905964-2905986 R
Solution sequence with flanking nucleotides: gttta ACTAGTGACTTGAGGAAAACCTA
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.41
Model logo: eno.2.model.LGO.gif
Sequence logo: eno.2.LGO.gif
Sequence Alignment: eno.2.ALGN
Solution location in genomic coordinates: 2905969-2905990 R
Solution sequence with flanking nucleotides: ttcag TTTAACTAGTGACTTGAGGAAA accta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA TF VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 6.98
Model logo: eno.3.model.LGO.gif
Sequence logo: eno.3.LGO.gif
Sequence Alignment: eno.3.ALGN
Solution location in genomic coordinates: 2906020-2906043 R
Solution sequence with flanking nucleotides: aaaaa AGTTAGAGCGGCAACGCGTACCCT gggta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: eno_pyrG_IR     Overlap: 13
Gene Index Page