epd Gene Page

Genbank name: epd
EcoGene name: epd
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10368
   Reported site,genomic coordinates and site type: DPInteract 3071833:3071848 fruR

Species that contributed to the solution: EC PA SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 25.61
Model logo: epd.1.model.LGO.gif
Sequence logo: epd.1.LGO.gif
Sequence Alignment: epd.1.ALGN
Solution location in genomic coordinates: 3071833-3071848 R
Solution sequence with flanking nucleotides: tccta GCTGAAGCGTTTCAGT cgatt
Number of overlapping basepairs with reported site: 16
Site type: fruR

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 18.33
Model logo: epd.2.model.LGO.gif
Sequence logo: epd.2.LGO.gif
Sequence Alignment: epd.2.ALGN
Solution location in genomic coordinates: 3071797-3071820 R
Solution sequence with flanking nucleotides: atgtt CGACAATTAACCAATCAGTCGCAG tttgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3071769-3071792 R
Solution sequence with flanking nucleotides: gtttg CGACAGGTAAGGTTTCCCCGGACG atttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.90
Model logo: epd.3.model.LGO.gif
Sequence logo: epd.3.LGO.gif
Sequence Alignment: epd.3.ALGN
Solution location in genomic coordinates: 3071787-3071805 R
Solution sequence with flanking nucleotides: ccaat CAGTCGCAGTTTGCGACAG gtaag
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page