exuR Gene Page

Genbank name: exuR
EcoGene name: exuR
Divergent gene:
Species with an ortholog: AA EC YP
EcoGene link: EG12739

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.35
Model logo: exuR.1.model.LGO.gif
Sequence logo: exuR.1.LGO.gif
Sequence Alignment: exuR.1.ALGN
Solution location in genomic coordinates: 3244246-3244261
Solution sequence with flanking nucleotides: cgcaa AAGTGGTATAACAAAT atagt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.32
Model logo: exuR.2.model.LGO.gif
Sequence logo: exuR.2.LGO.gif
Sequence Alignment: exuR.2.ALGN
Solution location in genomic coordinates: 3244193-3244212
Solution sequence with flanking nucleotides: ttcaa AGCCGCCTTCTCAGGCGGCT ttttc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: exuT_exuR_IR1 Overlap: 20

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.34
Model logo: exuR.3.model.LGO.gif
Sequence logo: exuR.3.LGO.gif
Sequence Alignment: exuR.3.ALGN
Solution location in genomic coordinates: 3244224-3244243
Solution sequence with flanking nucleotides: tcact GCGAGTAGAGCTAAACTCGC aaaag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: exuT_exuR_IR2 Overlap: 20

Gene Index Page