fabB Gene Page
Genbank name: fabB
EcoGene name: fabB
Divergent gene: yfcK
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10274
Species that contributed to the solution: AA EC HI ST TF VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 18.02
Model logo: fabB.1.model.LGO.gif
Sequence logo: fabB.1.LGO.gif
Sequence Alignment: fabB.1.ALGN
Solution location in genomic coordinates: 2439668-2439685 R
Solution sequence with flanking nucleotides: ggcgt ACAAGTGTACGCTATTGT gcatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.49
Model logo: fabB.2.model.LGO.gif
Sequence logo: fabB.2.LGO.gif
Sequence Alignment: fabB.2.ALGN
Solution location in genomic coordinates: 2439689-2439706 R
Solution sequence with flanking nucleotides: aatgg CTGATCGGACTTGTTCGG cgtac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 13.01
Model logo: fabB.3.model.LGO.gif
Sequence logo: fabB.3.LGO.gif
Sequence Alignment: fabB.3.ALGN
Solution location in genomic coordinates: 2439702-2439723 R
Solution sequence with flanking nucleotides: ATTTCTCTATTAAATGGCTGAT cggac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2439628-2439649 R
Solution sequence with flanking nucleotides: actct ATGTGCGACTTACAGAGGTATT ga
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page