fabF Gene Page

Genbank name: fabF
EcoGene name: fabF
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG12606

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 48.42
Model logo: fabF.1.model.LGO.gif
Sequence logo: fabF.1.LGO.gif
Sequence Alignment: fabF.1.ALGN
Solution location in genomic coordinates: 1151086-1151107
Solution sequence with flanking nucleotides: atctc CAGGCGGTCGTTCGACCGCCTG agttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: acpP_fabF_IR     Overlap: 22

Species that contributed to the solution: AA EC HI PA ST TF YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 38.77
Model logo: fabF.2.model.LGO.gif
Sequence logo: fabF.2.LGO.gif
Sequence Alignment: fabF.2.ALGN
Solution location in genomic coordinates: 1151117-1151136
Solution sequence with flanking nucleotides: ttatc TTTTTGTCCCACTAGAATCA ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1151140-1151159
Solution sequence with flanking nucleotides: cattt TTTCCCTCCCTGGAGGACAA ac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 18.56
Model logo: fabF.3.model.LGO.gif
Sequence logo: fabF.3.LGO.gif
Sequence Alignment: fabF.3.ALGN
Solution location in genomic coordinates: 1151076-1151098
Solution sequence with flanking nucleotides: taag TGAACATCTCCAGGCGGTCGTTC gaccg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: acpP_fabF_IR     Overlap: 13
Solution location in genomic coordinates: 1151139-1151161
Solution sequence with flanking nucleotides: tcatt TTTTCCCTCCCTGGAGGACAAAC
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page