fabH Gene Page

Genbank name: fabH
EcoGene name: fabH
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10277

Species that contributed to the solution: AA EC HI SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 14.40
Model logo: fabH.1.model.LGO.gif
Sequence logo: fabH.1.LGO.gif
Sequence Alignment: fabH.1.ALGN
Solution location in genomic coordinates: 1147955-1147978
Solution sequence with flanking nucleotides: acggt ATATAACCGAAAAGTGACTGAGCG tac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.55
Model logo: fabH.2.model.LGO.gif
Sequence logo: fabH.2.LGO.gif
Sequence Alignment: fabH.2.ALGN
Solution location in genomic coordinates: 1147919-1147935
Solution sequence with flanking nucleotides: gcagg ACGCTGCCAGCGAACTC gcagt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1147937-1147953
Solution sequence with flanking nucleotides: actcg CAGTTTGCAAGTGACGG tatat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.78
Model logo: fabH.3.model.LGO.gif
Sequence logo: fabH.3.LGO.gif
Sequence Alignment: fabH.3.ALGN
Solution location in genomic coordinates: 1147921-1147944
Solution sequence with flanking nucleotides: aggac GCTGCCAGCGAACTCGCAGTTTGC aagtg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page