fabI Gene Page

Genbank name: fabI
EcoGene name: fabI
Divergent gene:
Species with an ortholog: EC   HI   PA   ST   TF   
EcoGene link: EG11528

Species that contributed to the solution: EC PA ST TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 7.58
Model logo: fabI.1.model.LGO.gif
Sequence logo: fabI.1.LGO.gif
Sequence Alignment: fabI.1.ALGN
Solution location in genomic coordinates: 1349195-1349212 R
Solution sequence with flanking nucleotides: cccct GCCGCAGCCTGCTCCGGT cggac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 7.02
Model logo: fabI.2.model.LGO.gif
Sequence logo: fabI.2.LGO.gif
Sequence Alignment: fabI.2.ALGN
Solution location in genomic coordinates: 1349324-1349345 R
Solution sequence with flanking nucleotides: tgaac CGTCCCAGCCATCGCCATGAAA gggtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.66
Model logo: fabI.3.model.LGO.gif
Sequence logo: fabI.3.LGO.gif
Sequence Alignment: fabI.3.ALGN
Solution location in genomic coordinates: 1349112-1349130 R
Solution sequence with flanking nucleotides: cgtac TGTTTACTAAAACGACGAA tcgcc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page