fabZ Gene Page

Genbank name: fabZ
EcoGene name: fabZ
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG11284

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 21.10
Model logo: fabZ.1.model.LGO.gif
Sequence logo: fabZ.1.LGO.gif
Sequence Alignment: fabZ.1.ALGN
Solution location in genomic coordinates: 202018-202041
Solution sequence with flanking nucleotides: cgcca AACTTTACGGCCTGTCTCATTCTT acgat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: lpxD_fabZ_IR Overlap: 18
Solution location in genomic coordinates: 202042-202065
Solution sequence with flanking nucleotides: ttctt ACGATTGCGGCAGGCCGTGTTATT attgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: lpxD_fabZ_IR Overlap: 18

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 17.45
Model logo: fabZ.2.model.LGO.gif
Sequence logo: fabZ.2.LGO.gif
Sequence Alignment: fabZ.2.ALGN
Solution location in genomic coordinates: 202075-202098
Solution sequence with flanking nucleotides: tcgtt TCTTATATTTTGACAGGAAGAGTA tc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 11.69
Model logo: fabZ.3.model.LGO.gif
Sequence logo: fabZ.3.LGO.gif
Sequence Alignment: fabZ.3.ALGN
Solution location in genomic coordinates: 202030-202053
Solution sequence with flanking nucleotides: cggcc TGTCTCATTCTTACGATTGCGGCA ggccg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: lpxD_fabZ_IR Overlap: 24

Gene Index Page