fadD Gene Page
Genbank name: fadD
EcoGene name: fadD
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG11530
Reported site,genomic coordinates and site type: DPInteract 1887929:1887945 fadR
Reported site,genomic coordinates and site type: DPInteract 1887843:1887859 fadR
Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 23.31
Model logo: fadD.1.model.LGO.gif
Sequence logo: fadD.1.LGO.gif
Sequence Alignment: fadD.1.ALGN
Solution location in genomic coordinates: 1887828-1887846 R
Solution sequence with flanking nucleotides: tgatg AGTTAATATTATGTTAACG gcatg
Number of overlapping basepairs with reported site: 4
Site type: fadR
Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 19.59
Model logo: fadD.2.model.LGO.gif
Sequence logo: fadD.2.LGO.gif
Sequence Alignment: fadD.2.ALGN
Solution location in genomic coordinates: 1887953-1887970 R
Solution sequence with flanking nucleotides: attgc TTGTTTTTAAAGAAAAAG aaaca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: fadD_yeaY_IR     Overlap: 2
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.11
Model logo: fadD.3.model.LGO.gif
Sequence logo: fadD.3.LGO.gif
Sequence Alignment: fadD.3.ALGN
Solution location in genomic coordinates: 1887931-1887951 R
Solution sequence with flanking nucleotides: aaaga AACAGCGGCTGGTCCGCTGTT tctgc
Number of overlapping basepairs with reported site: 15
Site type: fadR
Repeat: fadD_yeaY_IR     Overlap: 21
Gene Index Page