fadL Gene Page

Genbank name: fadL
EcoGene name: fadL
Divergent gene: yfcZ
Species with an ortholog: EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG10280
   Reported site,genomic coordinates and site type: DPInteract 2459200:2459216 fadR
   Reported site,genomic coordinates and site type: DPInteract 2459224:2459240 fadR
   Reported site,genomic coordinates and site type: DPInteract 2459068:2459087 ompR
   Reported site,genomic coordinates and site type: DPInteract 2459157:2459176 ompR
   Reported site,genomic coordinates and site type: DPInteract 2459274:2459293 ompR
   Reported site,genomic coordinates and site type: DPInteract 2459336:2459355 ompR

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 21.97
Model logo: fadL.1.model.LGO.gif
Sequence logo: fadL.1.LGO.gif
Sequence Alignment: fadL.1.ALGN
Solution location in genomic coordinates: 2459073-2459095
Solution sequence with flanking nucleotides: aaatc ACACTTAAAAATGATCTAAAACA aaatt
Number of overlapping basepairs with reported site: 15
Site type: ompR
Solution location in genomic coordinates: 2459151-2459173
Solution sequence with flanking nucleotides: tcgcg TTTCTTAGATCATATTTGAAAAA agata
Number of overlapping basepairs with reported site: 17
Site type: ompR

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 20.28
Model logo: fadL.2.model.LGO.gif
Sequence logo: fadL.2.LGO.gif
Sequence Alignment: fadL.2.ALGN
Solution location in genomic coordinates: 2459290-2459306
Solution sequence with flanking nucleotides: taaca TAGTTTGTATAAAAATA aatca
Number of overlapping basepairs with reported site: 4
Site type: ompR

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 19.99
Model logo: fadL.3.model.LGO.gif
Sequence logo: fadL.3.LGO.gif
Sequence Alignment: fadL.3.ALGN
Solution location in genomic coordinates: 2459082-2459097
Solution sequence with flanking nucleotides: ttaaa AATGATCTAAAACAAA attca
Number of overlapping basepairs with reported site: 6
Site type: ompR
Solution location in genomic coordinates: 2459293-2459308
Solution sequence with flanking nucleotides: catag TTTGTATAAAAATAAA tcatt
Number of overlapping basepairs with reported site: 1
Site type: ompR


Gene Index Page