fbp Gene Page
Genbank name: fbp
EcoGene name: fbp
Divergent gene: mpl
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10283
Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 19.66
Model logo: fbp.1.model.LGO.gif
Sequence logo: fbp.1.LGO.gif
Sequence Alignment: fbp.1.ALGN
Solution location in genomic coordinates: 4453189-4453212 R
Solution sequence with flanking nucleotides: cgctt TACTCCATAAACATTGCAGGGAAA gtttt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.69
Model logo: fbp.2.model.LGO.gif
Sequence logo: fbp.2.LGO.gif
Sequence Alignment: fbp.2.ALGN
Solution location in genomic coordinates: 4453292-4453308 R
Solution sequence with flanking nucleotides: cgggc AAGTGAGAAACGCATTT cagga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 10.60
Model logo: fbp.3.model.LGO.gif
Sequence logo: fbp.3.LGO.gif
Sequence Alignment: fbp.3.ALGN
Solution location in genomic coordinates: 4453233-4453252 R
Solution sequence with flanking nucleotides: tgagc GCAACATTGAGATTATTTGT taaga
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page