ffh Gene Page
Genbank name: ffh
EcoGene name: ffh
Divergent gene: ypjD
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10300
Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 17.54
Model logo: ffh.1.model.LGO.gif
Sequence logo: ffh.1.LGO.gif
Sequence Alignment: ffh.1.ALGN
Solution location in genomic coordinates: 2745854-2745876 R
Solution sequence with flanking nucleotides: actgc GGCAAAATACTGATGATGTGTCG cgatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.51
Model logo: ffh.2.model.LGO.gif
Sequence logo: ffh.2.LGO.gif
Sequence Alignment: ffh.2.ALGN
Solution location in genomic coordinates: 2745816-2745839 R
Solution sequence with flanking nucleotides: ccaac CGTTTCCACCCCAGGCGAGAGACA
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC TF VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.10
Model logo: ffh.3.model.LGO.gif
Sequence logo: ffh.3.LGO.gif
Sequence Alignment: ffh.3.ALGN
Solution location in genomic coordinates: 2745882-2745905 R
Solution sequence with flanking nucleotides: a ACAACAAAGACGCCTTCATGTTAT actgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page