fhuE Gene Page

Genbank name: fhuE
EcoGene name: fhuE
Divergent gene: ycfF
Species with an ortholog: EC   PA   SP   ST   VC   YP   
EcoGene link: EG10306

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 26.17
Model logo: fhuE.1.model.LGO.gif
Sequence logo: fhuE.1.LGO.gif
Sequence Alignment: fhuE.1.ALGN
Solution location in genomic coordinates: 1160870-1160890 R
Solution sequence with flanking nucleotides: aatat GAATGCGTATATTTCTCATTT gcatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 10.64
Model logo: fhuE.2.model.LGO.gif
Sequence logo: fhuE.2.LGO.gif
Sequence Alignment: fhuE.2.ALGN
Solution location in genomic coordinates: 1160948-1160971 R
Solution sequence with flanking nucleotides: tgctg CCGTATATATCGCCATTATTCCCA tttct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1160873-1160896 R
Solution sequence with flanking nucleotides: atgac AAATATGAATGCGTATATTTCTCA tttgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 10.05
Model logo: fhuE.3.model.LGO.gif
Sequence logo: fhuE.3.LGO.gif
Sequence Alignment: fhuE.3.ALGN
Solution location in genomic coordinates: 1160986-1161009 R
Solution sequence with flanking nucleotides: caacc TTAACTCACGATTTCTTAAGCAAA aaatc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1160843-1160866 R
Solution sequence with flanking nucleotides: ttgca TTTACAAACAAAATTATTCGCACA ctaaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page