fliC Gene Page

Genbank name: fliC
EcoGene name: fliC
Divergent gene: fliD
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG10321 Reported site,genomic coordinates and site type: DPInteract 2001636:2001683 ihf

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 20.95
Model logo: fliC.1.model.LGO.gif
Sequence logo: fliC.1.LGO.gif
Sequence Alignment: fliC.1.ALGN
Solution location in genomic coordinates: 2001819-2001839 R
Solution sequence with flanking nucleotides: tctga ATTGCGCAAAGTTTACGTTTA attgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 15.83
Model logo: fliC.2.model.LGO.gif
Sequence logo: fliC.2.LGO.gif
Sequence Alignment: fliC.2.ALGN
Solution location in genomic coordinates: 2001733-2001752 R
Solution sequence with flanking nucleotides: aaatg GCTGTTTTTGAAAAAAATTC taaag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 11.25
Model logo: fliC.3.model.LGO.gif
Sequence logo: fliC.3.LGO.gif
Sequence Alignment: fliC.3.ALGN
Solution location in genomic coordinates: 2001844-2001864 R
Solution sequence with flanking nucleotides: gtaaa ACGAATACCGGGGTTATCGGT ctgaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2001693-2001713 R
Solution sequence with flanking nucleotides: cgaca GACGATAACAGGGTTGACGGC gattg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page