fliL Gene Page

Genbank name: fliL
EcoGene name: fliL
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG10322
   Reported site,genomic coordinates and site type: DPInteract 2017542:2017572 flhCD

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.13
Model logo: fliL.1.model.LGO.gif
Sequence logo: fliL.1.LGO.gif
Sequence Alignment: fliL.1.ALGN
Solution location in genomic coordinates: 2017594-2017613
Solution sequence with flanking nucleotides: acgca GGATAATTAGCCGATAAGCA gtagc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 11.63
Model logo: fliL.2.model.LGO.gif
Sequence logo: fliL.2.LGO.gif
Sequence Alignment: fliL.2.ALGN
Solution location in genomic coordinates: 2017551-2017568
Solution sequence with flanking nucleotides: agcac CGTAATCCGCGTCTTTTC cccgc
Number of overlapping basepairs with reported site: 18
Site type: flhCD
Solution location in genomic coordinates: 2017595-2017612
Solution sequence with flanking nucleotides: cgcag GATAATTAGCCGATAAGC agtag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.72
Model logo: fliL.3.model.LGO.gif
Sequence logo: fliL.3.LGO.gif
Sequence Alignment: fliL.3.ALGN
Solution location in genomic coordinates: 2017533-2017554
Solution sequence with flanking nucleotides: TAACGTCAGAGGTAGCACCGTA atccg
Number of overlapping basepairs with reported site: 13
Site type: flhCD
Solution location in genomic coordinates: 2017615-2017636
Solution sequence with flanking nucleotides: agcag TAGCGACACAGGAAGACCGCAA cac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page