folD Gene Page

Genbank name: folD
EcoGene name: folD
Divergent gene: sfmA
Species with an ortholog: AA EC HI PA ST TF VC YP
EcoGene link: EG10328

Species that contributed to the solution: AA EC HI PA ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 30.95
Model logo: folD.1.model.LGO.gif
Sequence logo: folD.1.LGO.gif
Sequence Alignment: folD.1.ALGN
Solution location in genomic coordinates: 557016-557037 R
Solution sequence with flanking nucleotides: aacct GACAGCGCGCCCCGCTTCTGAC aaaat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 27.02
Model logo: folD.2.model.LGO.gif
Sequence logo: folD.2.LGO.gif
Sequence Alignment: folD.2.ALGN
Solution location in genomic coordinates: 557290-557313 R
Solution sequence with flanking nucleotides: tatgc ACTCTATTCTAAAAAATAGAGAGC cccgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 21.59
Model logo: folD.3.model.LGO.gif
Sequence logo: folD.3.LGO.gif
Sequence Alignment: folD.3.ALGN
Solution location in genomic coordinates: 556966-556983 R
Solution sequence with flanking nucleotides: gtaac AGATGGAATCCTCTCTCT g
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page