fsr Gene Page
Genbank name: fsr
EcoGene name: fsr
Divergent gene: ushA
Species with an ortholog:
EC ST YP
EcoGene link: EG13268
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 6.32
Model logo: fsr.1.model.LGO.gif
Sequence logo: fsr.1.LGO.gif
Sequence Alignment: fsr.1.ALGN
Solution location in genomic coordinates: 504039-504056 R
Solution sequence with flanking nucleotides: aagat AAATCTGCATCCAGATTA gaaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 504019-504036 R
Solution sequence with flanking nucleotides: ttaga AATTCTGTATTCGGCGTT gagac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.63
Model logo: fsr.2.model.LGO.gif
Sequence logo: fsr.2.LGO.gif
Sequence Alignment: fsr.2.ALGN
Solution location in genomic coordinates: 503970-503991 R
Solution sequence with flanking nucleotides: tacag GTATGTTAGTCTGGTAATAATC acaaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.49
Model logo: fsr.3.model.LGO.gif
Sequence logo: fsr.3.LGO.gif
Sequence Alignment: fsr.3.ALGN
Solution location in genomic coordinates: 504102-504119 R
Solution sequence with flanking nucleotides: acctg ATTTCAACGTGTTGAAAA atagt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page