ftsJ Gene Page
Genbank name: ftsJ
EcoGene name: ftsJ
Divergent gene: yhbY
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG11507
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 43.33
Model logo: ftsJ.1.model.LGO.gif
Sequence logo: ftsJ.1.LGO.gif
Sequence Alignment: ftsJ.1.ALGN
Solution location in genomic coordinates: 3325387-3325409 R
Solution sequence with flanking nucleotides: gttgg GATTGAAAACGGGTCATTCTACC gccat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC ST TF YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.33
Model logo: ftsJ.2.model.LGO.gif
Sequence logo: ftsJ.2.LGO.gif
Sequence Alignment: ftsJ.2.ALGN
Solution location in genomic coordinates: 3325342-3325361 R
Solution sequence with flanking nucleotides: aaata GGCGCGTAAAAATTTACGCA attgg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.77
Model logo: ftsJ.3.model.LGO.gif
Sequence logo: ftsJ.3.LGO.gif
Sequence Alignment: ftsJ.3.ALGN
Solution location in genomic coordinates: 3325412-3325427 R
Solution sequence with flanking nucleotides: cgt ATTTTTTGCTTACGTT gggat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page