ftsK Gene Page
Genbank name: ftsK
EcoGene name: ftsK
Divergent gene:
Species with an ortholog:
EC ST VC YP
EcoGene link: EG13226
Reported site,genomic coordinates and site type: DPInteract 932351:932370 lexA
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 25.18
Model logo: ftsK.1.model.LGO.gif
Sequence logo: ftsK.1.LGO.gif
Sequence Alignment: ftsK.1.ALGN
Solution location in genomic coordinates: 932318-932336
Solution sequence with flanking nucleotides: cacgg AACAGGTGCAAAATCGGCG tattt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 932398-932416
Solution sequence with flanking nucleotides: ctgtt GTCCGTTTTAGCATCGGGC aggaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: lrp_ftsK_IR     Overlap: 1
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 24.72
Model logo: ftsK.2.model.LGO.gif
Sequence logo: ftsK.2.LGO.gif
Sequence Alignment: ftsK.2.ALGN
Solution location in genomic coordinates: 932349-932372
Solution sequence with flanking nucleotides: attac ACTCCTGTTAATCCATACAGCAAC agtac
Number of overlapping basepairs with reported site: 20
Site type: lexA
Repeat: lrp_ftsK_IR     Overlap: 4
Solution location in genomic coordinates: 932389-932412
Solution sequence with flanking nucleotides: aacct GGTACTGTTGTCCGTTTTAGCATC gggca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: lrp_ftsK_IR     Overlap: 10
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 19.10
Model logo: ftsK.3.model.LGO.gif
Sequence logo: ftsK.3.LGO.gif
Sequence Alignment: ftsK.3.ALGN
Solution location in genomic coordinates: 932310-932326
Solution sequence with flanking nucleotides: TAACACGGAACAGGTGC aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 932429-932445
Solution sequence with flanking nucleotides: gcctg TAACCTGGAGAGCCTTT c
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page