ftsZ Gene Page
Genbank name: ftsZ
EcoGene name: ftsZ
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10347
Species that contributed to the solution: EC PA ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 18.72
Model logo: ftsZ.1.model.LGO.gif
Sequence logo: ftsZ.1.LGO.gif
Sequence Alignment: ftsZ.1.ALGN
Solution location in genomic coordinates: 105253-105274
Solution sequence with flanking nucleotides: ttatg AGGCCGACGATGATTACGGCCT caggc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 105283-105304
Solution sequence with flanking nucleotides: gcgac AGGCACAAATCGGAGAGAAACT
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 14.13
Model logo: ftsZ.2.model.LGO.gif
Sequence logo: ftsZ.2.LGO.gif
Sequence Alignment: ftsZ.2.ALGN
Solution location in genomic coordinates: 105245-105263
Solution sequence with flanking nucleotides: taa TTTTTATGAGGCCGACGAT gatta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 105271-105289
Solution sequence with flanking nucleotides: ttacg GCCTCAGGCGACAGGCACA aatcg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page