fumC Gene Page

Genbank name: fumC
EcoGene name: fumC
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   ST   TF   VC   YP   
EcoGene link: EG10358
   Reported site,genomic coordinates and site type: DPInteract 1684693:1684727 soxS

Species that contributed to the solution: EC PA ST TF
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.65
Model logo: fumC.1.model.LGO.gif
Sequence logo: fumC.1.LGO.gif
Sequence Alignment: fumC.1.ALGN
Solution location in genomic coordinates: 1684732-1684749 R
Solution sequence with flanking nucleotides: acaga GCCGCCCTTCGGGGCGGT ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM27     Overlap: 18

Species that contributed to the solution: AA EC HI VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.61
Model logo: fumC.2.model.LGO.gif
Sequence logo: fumC.2.LGO.gif
Sequence Alignment: fumC.2.ALGN
Solution location in genomic coordinates: 1684680-1684701 R
Solution sequence with flanking nucleotides: acatt TGTTATCAAATGGTAAATAATA agtga
Number of overlapping basepairs with reported site: 9
Site type: soxS

Species that contributed to the solution: AA EC VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.31
Model logo: fumC.3.model.LGO.gif
Sequence logo: fumC.3.LGO.gif
Sequence Alignment: fumC.3.ALGN
Solution location in genomic coordinates: 1684659-1684678 R
Solution sequence with flanking nucleotides: aataa GTGAGCTAAAAGTTGCTTAA cgaaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page