fur Gene Page

Genbank name: fur
EcoGene name: fur
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10359
   Reported site,genomic coordinates and site type: DPInteract 710006:710027 crp
   Reported site,genomic coordinates and site type: DPInteract 709935:709952 fur

Species that contributed to the solution: EC HI SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 28.80
Model logo: fur.1.model.LGO.gif
Sequence logo: fur.1.LGO.gif
Sequence Alignment: fur.1.ALGN
Solution location in genomic coordinates: 710101-710117 R
Solution sequence with flanking nucleotides: aatag ATAATGCCAATCAAAAT aattg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 709935-709951 R
Solution sequence with flanking nucleotides: attct ATAATGATACGCATTAT ctcaa
Number of overlapping basepairs with reported site: 17
Site type: fur

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 15.62
Model logo: fur.2.model.LGO.gif
Sequence logo: fur.2.LGO.gif
Sequence Alignment: fur.2.ALGN
Solution location in genomic coordinates: 710080-710097 R
Solution sequence with flanking nucleotides: ataat TGCTACAAATTTGTAACT tttgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 709913-709930 R
Solution sequence with flanking nucleotides: tctca AGAGCAAATTCTGTCACT tcttc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST TF
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 12.66
Model logo: fur.3.model.LGO.gif
Sequence logo: fur.3.LGO.gif
Sequence Alignment: fur.3.ALGN
Solution location in genomic coordinates: 710137-710156 R
Solution sequence with flanking nucleotides: tgat GTGATGCGGCGTAGACTCAT gtcta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP64     Overlap: 20
Solution location in genomic coordinates: 709932-709951 R
Solution sequence with flanking nucleotides: attct ATAATGATACGCATTATCTC aagag
Number of overlapping basepairs with reported site: 17
Site type: fur


Gene Index Page