galE Gene Page

Genbank name: galE
EcoGene name: galE
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP
EcoGene link: EG10362    Reported site,genomic coordinates and site type: DPInteract 791335:791356 crp
   Reported site,genomic coordinates and site type: DPInteract 791357:791372 galR
   Reported site,genomic coordinates and site type: DPInteract 791244:791259 galR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 15.67
Model logo: galE.1.model.LGO.gif
Sequence logo: galE.1.LGO.gif
Sequence Alignment: galE.1.ALGN
Solution location in genomic coordinates: 791357-791372 R
Solution sequence with flanking nucleotides: ttctt GTGTAAACGATTCCAC taatt
Number of overlapping basepairs with reported site: 16
Site type: galR

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 12.81
Model logo: galE.2.model.LGO.gif
Sequence logo: galE.2.LGO.gif
Sequence Alignment: galE.2.ALGN
Solution location in genomic coordinates: 791439-791458 R
Solution sequence with flanking nucleotides: accgc GTCTTTTTTCAGATAAAAAG cgcaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 12.37
Model logo: galE.3.model.LGO.gif
Sequence logo: galE.3.LGO.gif
Sequence Alignment: galE.3.ALGN
Solution location in genomic coordinates: 791344-791366 R
Solution sequence with flanking nucleotides: tgtaa ACGATTCCACTAATTTATTCCAT gtcac
Number of overlapping basepairs with reported site: 13
Site type: crp galR
Solution location in genomic coordinates: 791298-791320 R
Solution sequence with flanking nucleotides: ttgtt ATGCTATGGTTATTTCATACCAT aagcc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page