galR Gene Page

Genbank name: galR
EcoGene name: galR
Divergent gene: aas
Species with an ortholog: EC   ST   VC   YP   
EcoGene link: EG10364
   Reported site,genomic coordinates and site type: DPInteract 2974591:2974606 galR
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 27.32
Model logo: galR.1.model.LGO.gif
Sequence logo: galR.1.LGO.gif
Sequence Alignment: galR.1.ALGN
Solution location in genomic coordinates: 2974130-2974151
Solution sequence with flanking nucleotides: aaaaa AACCTGCGCATCCGCGCAGGTT ggtgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2a     Overlap: 22
Repeat: aas_galR_IR1     Overlap: 22
Solution location in genomic coordinates: 2974332-2974353
Solution sequence with flanking nucleotides: aaaaa AACCTGCGCATCTGCGCAGGCT ggtgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2b     Overlap: 22
Repeat: aas_galR_IR3     Overlap: 18
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 25.84
Model logo: galR.2.model.LGO.gif
Sequence logo: galR.2.LGO.gif
Sequence Alignment: galR.2.ALGN
Solution location in genomic coordinates: 2974198-2974218
Solution sequence with flanking nucleotides: accaa TCAATACCTCTGGGATCTTGA ttgtg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2a     Overlap: 21
Repeat: aas_galR_IR2     Overlap: 21
Solution location in genomic coordinates: 2974394-2974414
Solution sequence with flanking nucleotides: accta TCAATACCTCTGGGATCACCA cttta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2b     Overlap: 21
Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.21
Model logo: galR.3.model.LGO.gif
Sequence logo: galR.3.LGO.gif
Sequence Alignment: galR.3.ALGN
Solution location in genomic coordinates: 2974590-2974607
Solution sequence with flanking nucleotides: gaaag AATGTAAGCGTTTACCCA ctaag
Number of overlapping basepairs with reported site: 16
Site type: galR


Gene Index Page