gidA Gene Page

Genbank name: gidA
EcoGene name: gidA
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10375

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 16
Number of E. coli sites in the solution: 2
Map value: 57.83
Model logo: gidA.1.model.LGO.gif
Sequence logo: gidA.1.LGO.gif
Sequence Alignment: gidA.1.ALGN
Solution location in genomic coordinates: 3923395-3923414 R
Solution sequence with flanking nucleotides: gatcc TAATAAGAGATCACAATAGA acaga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3923364-3923383 R
Solution sequence with flanking nucleotides: ctcta AATAAATAGATCTTCTTTTT aatac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 33.24
Model logo: gidA.2.model.LGO.gif
Sequence logo: gidA.2.LGO.gif
Sequence Alignment: gidA.2.ALGN
Solution location in genomic coordinates: 3923522-3923543 R
Solution sequence with flanking nucleotides: tgagt TGTGTATAACCCCTCATTCTGA tccca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3923484-3923505 R
Solution sequence with flanking nucleotides: acggt CCAGGATCACCGATCATTCACA gttaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: gidA_mioC_IR Overlap: 22

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 24.54
Model logo: gidA.3.model.LGO.gif
Sequence logo: gidA.3.LGO.gif
Sequence Alignment: gidA.3.ALGN
Solution location in genomic coordinates: 3923564-3923581 R
Solution sequence with flanking nucleotides: accgg TAGTTATCCAAAGAACAA ctgtt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page