glnP Gene Page

Genbank name: glnP
EcoGene name: glnP
Divergent gene:
Species with an ortholog: AA   EC   PA   ST   YP   
EcoGene link: EG10388

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 10.16
Model logo: glnP.1.model.LGO.gif
Sequence logo: glnP.1.LGO.gif
Sequence Alignment: glnP.1.ALGN
Solution location in genomic coordinates: 846459-846480 R
Solution sequence with flanking nucleotides: taa TAACGCTACACCTGTAAAACGC actgg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 846350-846371 R
Solution sequence with flanking nucleotides: ttgat TATTTACACCACGGTAACAGGA acaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.59
Model logo: glnP.2.model.LGO.gif
Sequence logo: glnP.2.LGO.gif
Sequence Alignment: glnP.2.ALGN
Solution location in genomic coordinates: 846426-846448 R
Solution sequence with flanking nucleotides: cagtt CCCTCTCCCCTATGGGGAGAGGA ttagg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: BOXC11     Overlap: 23
Solution location in genomic coordinates: 846350-846372 R
Solution sequence with flanking nucleotides: tttga TTATTTACACCACGGTAACAGGA acaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.90
Model logo: glnP.3.model.LGO.gif
Sequence logo: glnP.3.LGO.gif
Sequence Alignment: glnP.3.ALGN
Solution location in genomic coordinates: 846394-846414 R
Solution sequence with flanking nucleotides: tgagg GGCGCAAACCCGCTCCGGGGC catta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: BOXC11     Overlap: 6


Gene Index Page