glpT Gene Page
Genbank name: glpT
EcoGene name: glpT
Divergent gene: glpA
Species with an ortholog:
AA EC HI PA ST VC
EcoGene link: EG10401
Species that contributed to the solution: AA EC HI PA ST VC
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 19.04
Model logo: glpT.1.model.LGO.gif
Sequence logo: glpT.1.LGO.gif
Sequence Alignment: glpT.1.ALGN
Solution location in genomic coordinates: 2350593-2350614 R
Solution sequence with flanking nucleotides: catga ATTGTTTGATTTCGCGCATATT cgctc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2350503-2350524 R
Solution sequence with flanking nucleotides: ttaat AATGTGTGCGGCAATTCACATT taatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA ST VC
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 14.64
Model logo: glpT.2.model.LGO.gif
Sequence logo: glpT.2.LGO.gif
Sequence Alignment: glpT.2.ALGN
Solution location in genomic coordinates: 2350617-2350639 R
Solution sequence with flanking nucleotides: tttta CCATTTAGCCATAGTAAAAACAT gaatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2350476-2350498 R
Solution sequence with flanking nucleotides: ttaat TTATGAATGTTTTCTTAACATCG cggca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.96
Model logo: glpT.3.model.LGO.gif
Sequence logo: glpT.3.LGO.gif
Sequence Alignment: glpT.3.ALGN
Solution location in genomic coordinates: 2350532-2350548 R
Solution sequence with flanking nucleotides: ttttg AACATTTTGTAAATCTT attta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page