glpX Gene Page

Genbank name: glpX
EcoGene name: glpX
Divergent gene:
Species with an ortholog: EC   HI   ST   VC   
EcoGene link: EG11517

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 15.67
Model logo: glpX.1.model.LGO.gif
Sequence logo: glpX.1.LGO.gif
Sequence Alignment: glpX.1.ALGN
Solution location in genomic coordinates: 4113262-4113281 R
Solution sequence with flanking nucleotides: gccga ATGAAGCGTTTATGCCGCAT ccggt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt304     Overlap: 20
Solution location in genomic coordinates: 4113226-4113245 R
Solution sequence with flanking nucleotides: gaaac GTGCGGGGGCAACCCCGCAC acatc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 10.47
Model logo: glpX.2.model.LGO.gif
Sequence logo: glpX.2.LGO.gif
Sequence Alignment: glpX.2.ALGN
Solution location in genomic coordinates: 4113177-4113200 R
Solution sequence with flanking nucleotides: cccct GTGCTACACTTCGCGCCATTCCTT actgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 0.60
Model logo: glpX.3.model.LGO.gif
Sequence logo: glpX.3.LGO.gif
Sequence Alignment: glpX.3.ALGN
Solution location in genomic coordinates: 4113206-4113225 R
Solution sequence with flanking nucleotides: cgcac ACATCAATAATCCCTCCCTT cccct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page