gmk Gene Page

Genbank name: gmk
EcoGene name: gmk
Divergent gene: yicF
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10965

Species that contributed to the solution: EC PA TF YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 14.60
Model logo: gmk.1.model.LGO.gif
Sequence logo: gmk.1.LGO.gif
Sequence Alignment: gmk.1.ALGN
Solution location in genomic coordinates: 3818919-3818936
Solution sequence with flanking nucleotides: acagg CAAATGCGGAAGCAGCTA cgcaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 13.99
Model logo: gmk.2.model.LGO.gif
Sequence logo: gmk.2.LGO.gif
Sequence Alignment: gmk.2.ALGN
Solution location in genomic coordinates: 3818994-3819016
Solution sequence with flanking nucleotides: ggccg CGCCGTGTATAATAAGCTCGTAT gtagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 13.25
Model logo: gmk.3.model.LGO.gif
Sequence logo: gmk.3.LGO.gif
Sequence Alignment: gmk.3.ALGN
Solution location in genomic coordinates: 3818946-3818969
Solution sequence with flanking nucleotides: aaacg CAACAACTTTGCGCAAAAAGTGTG agcaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page