gpmA Gene Page

Genbank name: gpmA
EcoGene name: gpmA
Divergent gene:
Species with an ortholog: EC HI ST YP
EcoGene link: EG11699

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 27.83
Model logo: gpmA.1.model.LGO.gif
Sequence logo: gpmA.1.LGO.gif
Sequence Alignment: gpmA.1.ALGN
Solution location in genomic coordinates: 786844-786862 R
Solution sequence with flanking nucleotides: aatat AATGAGAATTATTATCATT aaaag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: gpmA_galM_IR Overlap: 19

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 25.26
Model logo: gpmA.2.model.LGO.gif
Sequence logo: gpmA.2.LGO.gif
Sequence Alignment: gpmA.2.ALGN
Solution location in genomic coordinates: 786897-786918 R
Solution sequence with flanking nucleotides: tgcgc CACTATTTTCGCTATGGTTATG cgtaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 786847-786868 R
Solution sequence with flanking nucleotides: cgcgg CAATATAATGAGAATTATTATC attaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: gpmA_galM_IR Overlap: 17

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 6.82
Model logo: gpmA.3.model.LGO.gif
Sequence logo: gpmA.3.LGO.gif
Sequence Alignment: gpmA.3.ALGN
Solution location in genomic coordinates: 786933-786956 R
Solution sequence with flanking nucleotides: gacat ATTTGCAACTCAATATTCACAACA acctt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 786864-786887 R
Solution sequence with flanking nucleotides: agcat TGCTGTTGCTTCGTCGCGGCAATA taatg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page