gppA Gene Page
Genbank name: gppA
EcoGene name: gpp
Divergent gene:
Species with an ortholog:
EC PA ST VC YP
EcoGene link: EG10413
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.50
Model logo: gppA.1.model.LGO.gif
Sequence logo: gppA.1.LGO.gif
Sequence Alignment: gppA.1.ALGN
Solution location in genomic coordinates: 3961930-3961953 R
Solution sequence with flanking nucleotides: atcat TCAAACTGTATCAAGATGGCAAGA gaatg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU15     Overlap: 24
Solution location in genomic coordinates: 3961857-3961880 R
Solution sequence with flanking nucleotides: agaat GCAGCCAACACAGAGACAGATTGA aggat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU15     Overlap: 24
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.34
Model logo: gppA.2.model.LGO.gif
Sequence logo: gppA.2.LGO.gif
Sequence Alignment: gppA.2.ALGN
Solution location in genomic coordinates: 3961909-3961925 R
Solution sequence with flanking nucleotides: agaat GAATCCCGATGAGCTTA ctgta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU15     Overlap: 17
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.17
Model logo: gppA.3.model.LGO.gif
Sequence logo: gppA.3.LGO.gif
Sequence Alignment: gppA.3.ALGN
Solution location in genomic coordinates: 3961954-3961972 R
Solution sequence with flanking nucleotides: aaaaa ATGTCATACTCAAAATCAT tcaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU15     Overlap: 19
Gene Index Page