gyrA Gene Page

Genbank name: gyrA
EcoGene name: gyrA
Divergent gene: ubiG
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10423
   Reported site,genomic coordinates and site type: DPInteract 2337575:2337594 cspA
   Reported site,genomic coordinates and site type: DPInteract 2337555:2337574 cspA
   Reported site,genomic coordinates and site type: DPInteract 2337527:2337546 cspA

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 17.54
Model logo: gyrA.1.model.LGO.gif
Sequence logo: gyrA.1.LGO.gif
Sequence Alignment: gyrA.1.ALGN
Solution location in genomic coordinates: 2337508-2337531 R
Solution sequence with flanking nucleotides: gatgt GAATAAAGCGTATAGGTTTACCTC aaact
Number of overlapping basepairs with reported site: 5
Site type: cspA
Solution location in genomic coordinates: 2337469-2337492 R
Solution sequence with flanking nucleotides: gctgt GTTATAATTTGCGACCTTTGAATC cggga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.43
Model logo: gyrA.2.model.LGO.gif
Sequence logo: gyrA.2.LGO.gif
Sequence Alignment: gyrA.2.ALGN
Solution location in genomic coordinates: 2337442-2337465 R
Solution sequence with flanking nucleotides: tccgg GATACAGTAGAGGGATAGCGGTTA g
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST TF YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 9.04
Model logo: gyrA.3.model.LGO.gif
Sequence logo: gyrA.3.LGO.gif
Sequence Alignment: gyrA.3.ALGN
Solution location in genomic coordinates: 2337535-2337551 R
Solution sequence with flanking nucleotides: aacga GTATATCAGGCATTGGA tgtga
Number of overlapping basepairs with reported site: 12
Site type: cspA
Solution location in genomic coordinates: 2337459-2337475 R
Solution sequence with flanking nucleotides: gacct TTGAATCCGGGATACAG tagag
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page