hcaT Gene Page

Genbank name: hcaT
EcoGene name: hcaT
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG13454

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 8.26
Model logo: hcaT.1.model.LGO.gif
Sequence logo: hcaT.1.LGO.gif
Sequence Alignment: hcaT.1.ALGN
Solution location in genomic coordinates: 2665909-2665931 R
Solution sequence with flanking nucleotides: tattc TTATTTTTCAACTTGCACCAACA ttcga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 7.47
Model logo: hcaT.2.model.LGO.gif
Sequence logo: hcaT.2.LGO.gif
Sequence Alignment: hcaT.2.ALGN
Solution location in genomic coordinates: 2665871-2665894 R
Solution sequence with flanking nucleotides: cccca GACTAACGCCTCCTGACGGGAGGG actc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 5.41
Model logo: hcaT.3.model.LGO.gif
Sequence logo: hcaT.3.LGO.gif
Sequence Alignment: hcaT.3.ALGN
Solution location in genomic coordinates: 2665942-2665964 R
Solution sequence with flanking nucleotides: ctggc GTTACAGACATCGGGAAGCAGGC tcgaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page