hemB Gene Page

Genbank name: hemB
EcoGene name: hemB
Divergent gene:
Species with an ortholog: AA   EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10428

Species that contributed to the solution: AA EC PA SP ST TF VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 4.81
Model logo: hemB.1.model.LGO.gif
Sequence logo: hemB.1.LGO.gif
Sequence Alignment: hemB.1.ALGN
Solution location in genomic coordinates: 388988-389009 R
Solution sequence with flanking nucleotides: aaaac ATCCCTACCCTGCTTCAGGTAT act
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC PA SP ST TF VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 4.52
Model logo: hemB.2.model.LGO.gif
Sequence logo: hemB.2.LGO.gif
Sequence Alignment: hemB.2.ALGN
Solution location in genomic coordinates: 389084-389105 R
Solution sequence with flanking nucleotides: tattt TCAGTGAATATAAAATTATTGC tgttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 389058-389079 R
Solution sequence with flanking nucleotides: ctgtt TCTATTAAAAAGATGTCCTGGC ctctc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 4.44
Model logo: hemB.3.model.LGO.gif
Sequence logo: hemB.3.LGO.gif
Sequence Alignment: hemB.3.ALGN
Solution location in genomic coordinates: 389011-389032 R
Solution sequence with flanking nucleotides: gtcaa CATCGCGACAACTTTCGTAAAA catcc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page