hemH Gene Page

Genbank name: hemH
EcoGene name: hemH
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10431

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.25
Model logo: hemH.1.model.LGO.gif
Sequence logo: hemH.1.LGO.gif
Sequence Alignment: hemH.1.ALGN
Solution location in genomic coordinates: 497203-497219
Solution sequence with flanking nucleotides: tttga CCTCTCACAGCAATTAG ttctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 10.61
Model logo: hemH.2.model.LGO.gif
Sequence logo: hemH.2.LGO.gif
Sequence Alignment: hemH.2.ALGN
Solution location in genomic coordinates: 497248-497268
Solution sequence with flanking nucleotides: acaat TATCAACAAGTTGAATCGATA agagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 10.07
Model logo: hemH.3.model.LGO.gif
Sequence logo: hemH.3.LGO.gif
Sequence Alignment: hemH.3.ALGN
Solution location in genomic coordinates: 497133-497148
Solution sequence with flanking nucleotides: cagca ATCTCAGGCCGGATAT tcatt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt45 Overlap: 9

Gene Index Page