himD Gene Page

Genbank name: himD
EcoGene name: ihfB
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10441
   Reported site,genomic coordinates and site type: DPInteract 962868:962915 ihf
   Reported site,genomic coordinates and site type: DPInteract 962942:962989 ihf

Species that contributed to the solution: EC PA ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 29.56
Model logo: himD.1.model.LGO.gif
Sequence logo: himD.1.LGO.gif
Sequence Alignment: himD.1.ALGN
Solution location in genomic coordinates: 962975-962996
Solution sequence with flanking nucleotides: gcact AAGGGCGGCTACGGCCGCCCTT aatca
Number of overlapping basepairs with reported site: 15
Site type: ihf
Repeat: rpsA_ihfB_IR     Overlap: 22

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 25.96
Model logo: himD.2.model.LGO.gif
Sequence logo: himD.2.LGO.gif
Sequence Alignment: himD.2.ALGN
Solution location in genomic coordinates: 962975-962996
Solution sequence with flanking nucleotides: gcact AAGGGCGGCTACGGCCGCCCTT aatca
Number of overlapping basepairs with reported site: 15
Site type: ihf
Repeat: rpsA_ihfB_IR     Overlap: 22
Solution location in genomic coordinates: 963000-963021
Solution sequence with flanking nucleotides: ttaat CAATGCAGCAACAGCAGCCGCT taatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.65
Model logo: himD.3.model.LGO.gif
Sequence logo: himD.3.LGO.gif
Sequence Alignment: himD.3.ALGN
Solution location in genomic coordinates: 962945-962966
Solution sequence with flanking nucleotides: gacag ATTGCAGGTTTCGTCCTGTAAT caagc
Number of overlapping basepairs with reported site: 22
Site type: ihf


Gene Index Page