hisG Gene Page
Genbank name: hisG
EcoGene name: hisG
Divergent gene:
Species with an ortholog:
EC HI SP ST TF VC YP
EcoGene link: EG10449
Reported site,genomic coordinates and site type: Neidhardt 2088051:2088162 stem-loop
Species that contributed to the solution: EC HI SP ST TF VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 31.32
Model logo: hisG.1.model.LGO.gif
Sequence logo: hisG.1.LGO.gif
Sequence Alignment: hisG.1.ALGN
Solution location in genomic coordinates: 2088135-2088157
Solution sequence with flanking nucleotides: aaagc CCCCGGAAGATCACCTTCCGGGG gcttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: hisL_hisG_IR     Overlap: 23
Species that contributed to the solution: EC HI SP ST TF VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 20.15
Model logo: hisG.2.model.LGO.gif
Sequence logo: hisG.2.LGO.gif
Sequence Alignment: hisG.2.ALGN
Solution location in genomic coordinates: 2088023-2088043
Solution sequence with flanking nucleotides: atgac ACGCGTTCAATTTAAACACCA ccatc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 17.82
Model logo: hisG.3.model.LGO.gif
Sequence logo: hisG.3.LGO.gif
Sequence Alignment: hisG.3.ALGN
Solution location in genomic coordinates: 2087911-2087932
Solution sequence with flanking nucleotides: attca TTAAACAAATCCATTGCCATAA aatat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page