hisS Gene Page

Repeat: hisS_gcpE_IR     Overlap: 9
Solution location in genomic coordinates: 2638622-2638640 R
Solution sequence with flanking nucleotides: attga GGGAAGCGTTGAGGGTTCA ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: hisS_gcpE_IR     Overlap: 19

---

Species that contributed to the solution: AA EC SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 22.30
Model logo: hisS.2.model.LGO.gif
Sequence logo: hisS.2.LGO.gif
Sequence Alignment: hisS.2.ALGN
Solution location in genomic coordinates: 2638597-2638619 R
Solution sequence with flanking nucleotides: tcatt TTTATATTCAGAAAGAGAATAAA c
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: hisS_gcpE_IR     Overlap: 18

---

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.76
Model logo: hisS.3.model.LGO.gif
Sequence logo: hisS.3.LGO.gif
Sequence Alignment: hisS.3.ALGN
Solution location in genomic coordinates: 2638651-2638668 R
Solution sequence with flanking nucleotides: atgat TGAACCCGCATGGCTCCC gaaac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: hisS_gcpE_IR     Overlap: 18
Solution location in genomic coordinates: 2638622-2638639 R
Solution sequence with flanking nucleotides: ttgag GGAAGCGTTGAGGGTTCA ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: hisS_gcpE_IR     Overlap: 18


Gene Index Page