htrA Gene Page
Genbank name: htrA
EcoGene name: degP
Divergent gene:
Species with an ortholog:
EC ST VC YP
EcoGene link: EG10463
Reported site,genomic coordinates and site type: PMID:9159398 180763:180798 cpxR
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 22.29
Model logo: htrA.1.model.LGO.gif
Sequence logo: htrA.1.LGO.gif
Sequence Alignment: htrA.1.ALGN
Solution location in genomic coordinates: 180770-180792
Solution sequence with flanking nucleotides: gtaaa GACGAACAATAAATTTTTACCTT ttgca
Number of overlapping basepairs with reported site: 23
Site type: cpxR
Solution location in genomic coordinates: 180837-180859
Solution sequence with flanking nucleotides: aatct GAAGAACACAGCAATTTTGCGTT atctg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.56
Model logo: htrA.2.model.LGO.gif
Sequence logo: htrA.2.LGO.gif
Sequence Alignment: htrA.2.ALGN
Solution location in genomic coordinates: 180781-180804
Solution sequence with flanking nucleotides: caata AATTTTTACCTTTTGCAGAAACTT tagtt
Number of overlapping basepairs with reported site: 18
Site type: cpxR
Solution location in genomic coordinates: 180813-180836
Solution sequence with flanking nucleotides: ttcgg AACTTCAGGCTATAAAACGAATCT gaaga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 17.84
Model logo: htrA.3.model.LGO.gif
Sequence logo: htrA.3.LGO.gif
Sequence Alignment: htrA.3.ALGN
Solution location in genomic coordinates: 180760-180777
Solution sequence with flanking nucleotides: ccagg CTTTTGTAAAGACGAACA ataaa
Number of overlapping basepairs with reported site: 15
Site type: cpxR
Solution location in genomic coordinates: 180863-180880
Solution sequence with flanking nucleotides: ttatc TGTTAATCGAGACTGAAA tac
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page