ibpB Gene Page

Genbank name: ibpB
EcoGene name: ibpB
Divergent gene:
Species with an ortholog: EC ST YP
EcoGene link: EG11535

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 17.63
Model logo: ibpB.1.model.LGO.gif
Sequence logo: ibpB.1.LGO.gif
Sequence Alignment: ibpB.1.ALGN
Solution location in genomic coordinates: 3864533-3864549 R
Solution sequence with flanking nucleotides: cttac TCGCTTCTTAGAAGGAG aa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 17.12
Model logo: ibpB.2.model.LGO.gif
Sequence logo: ibpB.2.LGO.gif
Sequence Alignment: ibpB.2.ALGN
Solution location in genomic coordinates: 3864580-3864600 R
Solution sequence with flanking nucleotides: tctcc ATGCTCGCCGTCAGGGAGCAT atgcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 16.60
Model logo: ibpB.3.model.LGO.gif
Sequence logo: ibpB.3.LGO.gif
Sequence Alignment: ibpB.3.ALGN
Solution location in genomic coordinates: 3864580-3864600 R
Solution sequence with flanking nucleotides: tctcc ATGCTCGCCGTCAGGGAGCAT atgcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3864533-3864553 R
Solution sequence with flanking nucleotides: ggtac TTACTCGCTTCTTAGAAGGAG aa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page