iclR Gene Page

Genbank name: iclR
EcoGene name: iclR
Divergent gene: metH
Species with an ortholog: EC   ST   YP
EcoGene link: EG10491    Reported site,genomic coordinates and site type: DPInteract 4221277:4221293 fadR
   Reported site,genomic coordinates and site type: DPInteract 4221231:4221245 iclR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 18.74
Model logo: iclR.1.model.LGO.gif
Sequence logo: iclR.1.LGO.gif
Sequence Alignment: iclR.1.ALGN
Solution location in genomic coordinates: 4221277-4221293 R
Solution sequence with flanking nucleotides: acatt AACTCATCGGATCAGTT cagta
Number of overlapping basepairs with reported site: 17
Site type: fadR

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 7.47
Model logo: iclR.2.model.LGO.gif
Sequence logo: iclR.2.LGO.gif
Sequence Alignment: iclR.2.ALGN
Solution location in genomic coordinates: 4221360-4221379 R
Solution sequence with flanking nucleotides: ccaga TTTAATAAAAATTCAACAAA ccata
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4221248-4221267 R
Solution sequence with flanking nucleotides: aacta TTGCATTAGCTAACAATAAA a
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.93
Model logo: iclR.3.model.LGO.gif
Sequence logo: iclR.3.LGO.gif
Sequence Alignment: iclR.3.ALGN
Solution location in genomic coordinates: 4221300-4221316 R
Solution sequence with flanking nucleotides: ccacg CAACATGAGATTTGTTC aacat
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page