idnR Gene Page
Genbank name: idnR
EcoGene name: idnR
Divergent gene:
Species with an ortholog:
AA EC ST VC YP
EcoGene link: EG12538
Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 4.09
Model logo: idnR.1.model.LGO.gif
Sequence logo: idnR.1.LGO.gif
Sequence Alignment: idnR.1.ALGN
Solution location in genomic coordinates: 4488725-4488745 R
Solution sequence with flanking nucleotides: tttcg GGGGAAGATTGAAGATTCCCC cgacg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: idnR_idnT_IR     Overlap: 21
Species that contributed to the solution: AA EC VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 3.68
Model logo: idnR.2.model.LGO.gif
Sequence logo: idnR.2.LGO.gif
Sequence Alignment: idnR.2.ALGN
Solution location in genomic coordinates: 4488749-4488771 R
Solution sequence with flanking nucleotides: tgaaa GAATAAAATATTGTGATGTAGTT tcggg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page