ilvC Gene Page

Genbank name: ilvC
EcoGene name: ilvC
Divergent gene: ilvY
Species with an ortholog: EC   HI   SP   ST   VC   YP   
EcoGene link: EG10495
   Reported site,genomic coordinates and site type: DPInteract 3955461:3955487 ilvY
   Reported site,genomic coordinates and site type: DPInteract 3955492:3955518 ilvY

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 76.20
Model logo: ilvC.1.model.LGO.gif
Sequence logo: ilvC.1.LGO.gif
Sequence Alignment: ilvC.1.ALGN
Solution location in genomic coordinates: 3955463-3955481
Solution sequence with flanking nucleotides: gttga CGTTGCAAAAATTGCAATG tgacg
Number of overlapping basepairs with reported site: 19
Site type: ilvY
Solution location in genomic coordinates: 3955494-3955512
Solution sequence with flanking nucleotides: gtgaa TATATCAATTTCCGCAATA aattt
Number of overlapping basepairs with reported site: 19
Site type: ilvY

Species that contributed to the solution: EC SP YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.81
Model logo: ilvC.2.model.LGO.gif
Sequence logo: ilvC.2.LGO.gif
Sequence Alignment: ilvC.2.ALGN
Solution location in genomic coordinates: 3955526-3955541
Solution sequence with flanking nucleotides: gtcat ATAGTGAATTCAATCT cgcaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 5.62
Model logo: ilvC.3.model.LGO.gif
Sequence logo: ilvC.3.LGO.gif
Sequence Alignment: ilvC.3.ALGN
Solution location in genomic coordinates: 3955548-3955567
Solution sequence with flanking nucleotides: gcaaa CGCGAACCGAACAATAAGAA gcaca
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page